Lab Reagents
Human IgG antibody Laboratories manufactures the zeptometrix rp2 controls reagents distributed by Genprice. The Zeptometrix Rp2 Controls reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Zeptometrix. Other Zeptometrix products are available in stock. Specificity: Zeptometrix Category: Rp2 Group: Controls
Controls information
anti-RP2 |
YF-PA14418 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to RP2 |
anti-RP2 |
YF-PA24596 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to RP2 |
RP2 Blocking Peptide |
33R-4895 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RP2 antibody, catalog no. 70R-4335 |
Anti-RP2 Antibody |
A01923-1 |
BosterBio |
100ug/vial |
EUR 334 |
RP2 cloning plasmid |
CSB-CL020076HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1053
- Sequence: atgggctgcttcttctccaagagacggaaggctgacaaggagtcgcggcccgagaacgaggaggagcggccaaagcagtacagctgggatcagcgcgagaaggttgatccaaaagactacatgttcagtggactgaaggatgaaacagtaggtcgcttacctgggacggtagcag
- Show more
|
Description: A cloning plasmid for the RP2 gene. |
anti- RP2 antibody |
FNab07390 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: retinitis pigmentosa 2
- Uniprot ID: O75695
- Gene ID: 6102
- Research Area: Neuroscience, Metabolism
|
Description: Antibody raised against RP2 |
Anti-RP2 antibody |
STJ400101 |
St John's Laboratory |
1 mg |
EUR 338 |
Description: Malaria is caused by protozoan parasites belonging to the genus Plasmodium. The majority of malaria-related deaths are linked to the species Plasmodium falciparum. Monoclonal antibodies against P. falciparum histidine-rich protein 2 (HRP2) are widely used in malaria rapid diagnostic tests as the parasite secretes substantial amounts of the protein into the host bloodstream. |
Anti-RP2 antibody |
STJ400102 |
St John's Laboratory |
1 mg |
EUR 338 |
Description: Malaria is caused by protozoan parasites belonging to the genus Plasmodium. The majority of malaria-related deaths are linked to the species Plasmodium falciparum. Monoclonal antibodies against P. falciparum histidine-rich protein 2 (HRP2) are widely used in malaria rapid diagnostic tests as the parasite secretes substantial amounts of the protein into the host bloodstream. |
Anti-RP2 (1B4) |
YF-MA15234 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RP2 |
Anti-RP2 (5C10) |
YF-MA15235 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RP2 |
Rocking platform for RotoBot |
R4045-RP2 |
BenchMark |
1 PC |
EUR 805.88 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
Human Protein XRP2 (RP2) |
1-CSB-EP020076HU |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 66.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protein XRP2(RP2) expressed in E.coli |
Protein XRP2 (RP2) Antibody |
abx146444-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Mouse RP2 shRNA Plasmid |
20-abx972483 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Protein XRP2 (RP2) Antibody |
20-abx320768 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|