Zeptometrix Rp2 Controls

Lab Reagents

Human IgG antibody Laboratories manufactures the zeptometrix rp2 controls reagents distributed by Genprice. The Zeptometrix Rp2 Controls reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Zeptometrix. Other Zeptometrix products are available in stock. Specificity: Zeptometrix Category: Rp2 Group: Controls

Controls information


YF-PA14418 100 ug
EUR 403
Description: Rabbit polyclonal to RP2


YF-PA24596 50 ul
EUR 334
Description: Mouse polyclonal to RP2

RP2 cloning plasmid

CSB-CL020076HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1053
  • Sequence: atgggctgcttcttctccaagagacggaaggctgacaaggagtcgcggcccgagaacgaggaggagcggccaaagcagtacagctgggatcagcgcgagaaggttgatccaaaagactacatgttcagtggactgaaggatgaaacagtaggtcgcttacctgggacggtagcag
  • Show more
Description: A cloning plasmid for the RP2 gene.

anti- RP2 antibody

FNab07390 100µg
EUR 548.75
  • Immunogen: retinitis pigmentosa 2
  • Uniprot ID: O75695
  • Gene ID: 6102
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against RP2

Anti-RP2 Antibody

A01923-1 100ug/vial
EUR 334

RP2 Blocking Peptide

33R-4895 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RP2 antibody, catalog no. 70R-4335

Anti-RP2 antibody

PAab07390 100 ug
EUR 386

Anti-RP2 antibody

STJ400101 1 mg
EUR 338
Description: Malaria is caused by protozoan parasites belonging to the genus Plasmodium. The majority of malaria-related deaths are linked to the species Plasmodium falciparum. Monoclonal antibodies against P. falciparum histidine-rich protein 2 (HRP2) are widely used in malaria rapid diagnostic tests as the parasite secretes substantial amounts of the protein into the host bloodstream.

Anti-RP2 antibody

STJ400102 1 mg
EUR 338
Description: Malaria is caused by protozoan parasites belonging to the genus Plasmodium. The majority of malaria-related deaths are linked to the species Plasmodium falciparum. Monoclonal antibodies against P. falciparum histidine-rich protein 2 (HRP2) are widely used in malaria rapid diagnostic tests as the parasite secretes substantial amounts of the protein into the host bloodstream.

Anti-RP2 (1B4)

YF-MA15234 100 ug
EUR 363
Description: Mouse monoclonal to RP2

Anti-RP2 (5C10)

YF-MA15235 100 ug
EUR 363
Description: Mouse monoclonal to RP2

Rocking platform for RotoBot

R4045-RP2 1 PC
EUR 805.88
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.


EF002549 96 Tests
EUR 689

Protein XRP2 (RP2) Antibody

abx146444-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein XRP2 (RP2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein XRP2 (RP2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein XRP2 (RP2) Antibody

abx237390-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.