Pcr Sars2 Cost

Lab Reagents

Human IgG antibody Laboratories manufactures the pcr sars2 cost reagents distributed by Genprice. The Pcr Sars2 Cost reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Pcr. Other Pcr products are available in stock. Specificity: Pcr Category: Sars2 Group: Cost

Cost information

SARS2 Rabbit pAb

A12297-200ul 200 ul
EUR 459

SARS2 Rabbit pAb

A12297-20ul 20 ul
EUR 183

SARS2 Rabbit pAb

A12297-50ul 50 ul
EUR 223

SARS2 Polyclonal Antibody

27672-100ul 100ul
EUR 252

SARS2 Polyclonal Antibody

27672-50ul 50ul
EUR 187

SARS2 cloning plasmid

CSB-CL878836HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: atggctgcgtccatggcgcggcgcttgtggcctttgctgactcgtcgggggttccggccccggggaggctgcatctccaacgatagtccaaggagaagtttcactacagagaaacgaaaccggaacctcctgtacgagtatgcgcgcgagggctacagcgcactccctcagctgg
  • Show more
Description: A cloning plasmid for the SARS2 gene.

Anti-SARS2 antibody

PAab07610 100 ug
EUR 386

Anti-SARS2 antibody

STJ114185 100 µl
EUR 277
Description: This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene.

MULTIPLEX KIT PCR Babesia & Theileria PCR kit

PCR-MPX401-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of MULTIPLEX KIT PCR Babesia & Theileria

MULTIPLEX KIT PCR Babesia & Theileria PCR kit

PCR-MPX401-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of MULTIPLEX KIT PCR Babesia & Theileria

Halobacillus PCR kit

PCR-A635-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Halobacillus

Halobacillus PCR kit

PCR-A635-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Halobacillus

Enterovirus PCR kit

PCR-H433-48R 50T
EUR 524.4
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Enterovirus

Enterovirus PCR kit

PCR-H433-96R 100T
EUR 669.4
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Enterovirus

Mengovirus PCR kit

PCR-H453-48R 50T
EUR 524.4
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Mengovirus

Mengovirus PCR kit

PCR-H453-96R 100T
EUR 669.4
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Mengovirus

Astrovirus PCR kit

PCR-H491-48R 50T
EUR 524.4
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Astrovirus