Lab Reagents
Human IgG antibody Laboratories manufactures the pcr sars2 cost reagents distributed by Genprice. The Pcr Sars2 Cost reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Pcr. Other Pcr products are available in stock. Specificity: Pcr Category: Sars2 Group: Cost
Cost information
SARS2 Rabbit pAb |
A12297-200ul |
Abclonal |
200 ul |
EUR 459 |
SARS2 Rabbit pAb |
A12297-20ul |
Abclonal |
20 ul |
EUR 183 |
SARS2 Rabbit pAb |
A12297-50ul |
Abclonal |
50 ul |
EUR 223 |
SARS2 Polyclonal Antibody |
27672-100ul |
SAB |
100ul |
EUR 252 |
SARS2 Polyclonal Antibody |
27672-50ul |
SAB |
50ul |
EUR 187 |
SARS2 cloning plasmid |
CSB-CL878836HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1557
- Sequence: atggctgcgtccatggcgcggcgcttgtggcctttgctgactcgtcgggggttccggccccggggaggctgcatctccaacgatagtccaaggagaagtttcactacagagaaacgaaaccggaacctcctgtacgagtatgcgcgcgagggctacagcgcactccctcagctgg
- Show more
|
Description: A cloning plasmid for the SARS2 gene. |
Anti-SARS2 antibody |
STJ114185 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene. |
MULTIPLEX KIT PCR Babesia & Theileria PCR kit |
PCR-MPX401-48D |
Bioingentech |
50T |
EUR 425.8 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of MULTIPLEX KIT PCR Babesia & Theileria |
MULTIPLEX KIT PCR Babesia & Theileria PCR kit |
PCR-MPX401-96D |
Bioingentech |
100T |
EUR 521.5 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of MULTIPLEX KIT PCR Babesia & Theileria |
Halobacillus PCR kit |
PCR-A635-48D |
Bioingentech |
50T |
EUR 425.8 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Halobacillus |
Halobacillus PCR kit |
PCR-A635-96D |
Bioingentech |
100T |
EUR 521.5 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Halobacillus |
Enterovirus PCR kit |
PCR-H433-48R |
Bioingentech |
50T |
EUR 524.4 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Enterovirus |
Enterovirus PCR kit |
PCR-H433-96R |
Bioingentech |
100T |
EUR 669.4 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Enterovirus |
Mengovirus PCR kit |
PCR-H453-48R |
Bioingentech |
50T |
EUR 524.4 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Mengovirus |
Mengovirus PCR kit |
PCR-H453-96R |
Bioingentech |
100T |
EUR 669.4 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Mengovirus |
Astrovirus PCR kit |
PCR-H491-48R |
Bioingentech |
50T |
EUR 524.4 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Astrovirus |